Aptamer - Gint4.T
Gint4.T, a nuclease resistant RNAaptamer, is able to specifically bind to the human PDGFR ectodomain (Kd, 9.6 nM) causing a strong inhibition of ligand-dependent receptor activation and of downstream signaling in cell lines and primary cultures of human glioblastoma cells. It drastically inhibits cell migration and proliferation, induces differentiation, and blocks tumor growth in vivo. Gint4.T aptamer prevents PDGFR heterodimerization with and resultant transactivation of epidermal growth factor receptor (EGFR).
Category:
modified RNA
Last revision: Nov 25, 2014
Author(s):
L. Cerchia, V. de Franciscis
Contact
Name: Laura Cerchia
Address: Institute of Experimental Endocrinology and Oncology “G. Salvatore”, CNR, via Pansini 5, 80313 Naples Italy
Phone: +390813722343
Email: l.cerchia@ieos.cnr.it
Figure legend:
Secondary structure of Gint4.T
Molecular Weight: 10.661 KDa
Molecular target
human Platelet-derived growth factor receptor (PDGFR)
Kd: 9.6 nmol/l
Primary structure: 5’UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACA3’
Nucleotide modification(s): 2’ F Py in the entire sequence. 2’F-Py RNAs were used because of their increased resistance to degradation by seric nucleases
Description of selection strategy: Cell-internalization SELEX Following 14 rounds of selection performed onto U87MG cells as previously described (ref Axl), the enriched pool was incubated onto U87MG for 30 minutes (first internalization round) and 15 minutes (second internalization round) at 37°C and unbound aptamers were removed by five washes with DMEM serum free. To remove surfacebound aptamers, target cells were treated with 0.5 μg/μl proteinase K (Roche Diagnostics, Indianapolis, IN) for 30 minutes, washed with DMEM serum free and internalized RNA aptamers were then recovered by RNA extraction and RT-PCR.
Intended Use: Treatment and/or the diagnosis of a tumour expressing PDGFRβ
Quality validation:
Yes
Validation info
The Gint4.T aptamer has been published in a peer-reviewed journal.
