Aptamer - GL21.T
GL21.T binds the extracellular domain of human Axl receptor tyrosine kinase. GL21.T blocked Axl-dependent transducing events in vitro, cell migration and invasion, as well as in vivo lung tumor formation in mice xenografts. Furthermore, because of its ability to rapidly internalize within Axl-positive target cells it is a highly promising candidate as cargo for tissue specific internalization. GL21.T represents a promising therapeutic molecule for Axl-dependent cancers whose importance is highlighted by the paucity of available Axl-specific inhibitory molecules.
Category:
modified RNA
Last revision: Nov 25, 2014
Author(s):
L.Cerchia, V. de Franciscis
Contact
Name: Laura Cerchia
Address: Institute of Experimental Endocrinology and Oncology “G. Salvatore” , CNR via pansini 5 80131 Naples Italy
Phone: +39 081 3722343
Email: l.cerchia@ies.cnr.it
Figure legend:
Secondary structure GL21.T
Molecular Weight: 10.875 KDa
Molecular target
human Axl tyrosine kinase receptor (RTK)
Kd: 12 nmol/l
Primary structure: 5’AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC3’
Nucleotide modification(s): 2’ F Py in the entire sequence. 2’F-Py RNAs were used because of their increased resistance to degradation by seric nucleases
Description of selection strategy: GL21.T was generated by a cell-SELEX approach. Briefly, the SELEX cycle was performed essentially as described. Transcription was performed in the presence of 1 mM 2’-F pyrimidines and a mutant form of T7 RNA polymerase.
2’FPy RNAs (800-300 pmol) were heated at 85uC for 5 min in 1.5 ml of DMEM serum free, snap-cooled on ice for 2 min, and allowed to warm up to 37uC. Before incubation with the cells, 13.5 ml of medium were added to RNA to reach a final volume of 15 ml. Counterselection against T98G cells. To avoid selecting for aptamers non-specifically recognizing the U87MG cell surface, the pool was first incubated for 30 min (up to round 9) or for 15 min (for the following rounds) at 37°C with 107 T98G cells (150-mm cell plate), and unbound sequences were recovered for the selection phase. This step was meant to select sequences recognizing specifically the U87MG cells. Selection against U87MG cells. The recovered sequences were incubated with 107 U87MG cells for 30 min at 37°C and recovered after several washings with 5 ml of DMEM serum free by total RNA extraction. During the selection process, we progressively increased the selective pressure by increasing the number of washings (from one for the first cycle up to five for the last cycles) and by decreasing the incubation time (from 30 to 15 min from round 9).
Intended Use: Treatment and/or the diagnosis of a tumour expressing Axl
Quality validation:
Yes
Validation info
The GL21.T has been published in a peer-reviewed journal
| Citations |
|---|
| Cerchia L, Esposito CL, Camorani S, Rienzo A, Stasio L, Insabato L, Affuso A, de Franciscis. Targeting Axl With an High-affinity Inhibitory Aptamer. V,. Mol Ther. 2012;20:2291-303. |
| Cerchia L, de Franciscis V. AXL receptor tyrosine kinase aptamer inhibitor for use in therapy. Domanda di brevetto in Italia n. RM2010A000537 del 12/10/2010, esteso PCT il 10/10/2011, nazionalizzato in Europa (pending) e USA (pending). |
