Aptamer - CL4
CL4 is a nuclease resistant RNA-aptamer that specifically binds to EGFR with a binding constant of 10 nM. When applied to EGFR-expressing cancer cells the aptamer inhibits EGFR-mediated signal pathways causing selective cell death. Furthermore, at low doses it induces apoptosis even of cells that are resistant to the most frequently used EGFR-inhibitors, such as gefitinib and cetuximab, and inhibits tumor growth in a mouse xenograft model of human non-small-cell lung cancer (NSCLC). Interestingly, combined treatment with cetuximab and the aptamer shows clear synergy in inducing apoptosis in vitro and in vivo.
Category:
modified RNA
Last revision: Nov 25, 2014
Author(s):
L.Cerchia, V.de Franciscis
Contact
Name: Laura Cerchia
Address: Institute of Experimental Endocrinology and Oncology “G. Salvatore”,Institute of Experimental Endocrinology and Oncology “G. Salvatore”, CNR, via Pansini 5, 80313 Naples Italy
Phone: +39 081 3722343
Figure legend:
Secondary structure of CL4
Molecular Weight: 12.563 KDa
Molecular target
human epidermal growth factor receptor (EGFR)
Kd: 10 nmol/l
Primary structure: 5’GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3’
Nucleotide modification(s): 2’ F Py in the entire sequence. 2’F-Py RNAs were used because of their increased resistance to degradation by seric nucleases
Description of selection strategy: CL4 was generated by a cell-SELEX approach. Briefly, the SELEX cycle was performed essentially as described. Transcription was performed in the presence of 1 mM 2’-F pyrimidines and a mutant form of T7 RNA polymerase.
2’FPy RNAs (800-300 pmol) were heated at 85uC for 5 min in 1.5 ml of DMEM serum free, snap-cooled on ice for 2 min, and allowed to warm up to 37uC. Before incubation with the cells, 13.5 ml of medium were added to RNA to reach a final volume of 15 ml. Counterselection against NSCLC H460 cells. To avoid selecting for aptamers non-specifically recognizing the NSCLC A549 cell surface, the pool was first incubated for 30 min (up to round 9) or for 15 min (for the following rounds) at 37°C with 107 H460 cells (150-mm cell plate), and unbound sequences were recovered for the selection phase. This step was meant to select sequences recognizing specifically the A549 cells. Selection against A549 cells. The recovered sequences were incubated with 107 A549 cells for 30 min at 37°C and recovered after several washings with 5 ml of DMEM serum free by total RNA extraction. During the selection process, we progressively increased the selective pressure by increasing the number of washings (from one for the first cycle up to five for the last cycles) and by decreasing the incubation time (from 30 to 15 min from round 9).
Intended Use: Treatment and/or the diagnosis of a tumour expressing EGFR
Quality validation:
Yes
Validation info
The CL4 aptamer has been patented and published in a peer-reviewed journal
