Oligo - alpha intergene 3’ (control P2)
Oligonucleotide for a PCR control amplification
Category:
DNA
Creation date: Nov 21, 2002
Last revision: Jan 27, 2016
Author(s):
Giuseppina Lacerra
Contact
Name: Giuseppina Lacerra
Address: Institute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone: +39 081 6132602
Sequence
CAATAGCTGGAACCGGCTGGAG
Orientation: reverse
Position: 36656-35 respect to the Gene Bank sequence NG_000006.1.
Length (nt): 22
Melting Temperature (°C): 63
% GC: 59
Degeneration: no
Intended Use: The oligonucleotide has to be used in association with the oligo alpha intergene 5’ to generate a control amplicon of 714 bp. The oligonucleotide has to be used in association with the oligo 5' alpha to generate a control amplicon of 348 bp.
Quality validation:
Yes
Validation info
The oligo alpha intergene 3’ has been published and used to obtain data published in the peer-reviewed journals reported below.
Funded by: Ministero Istruzione, Università e Ricerca (MIUR), Legge 488/92, Cluster C02, Project 2.
Related Oligos: