Home | Molecular Tools | Oligos | 5’ alpha

Oligo - 5’ alpha

Oligonucleotide for a PCR control amplification

Category: DNA

Creation date: Jul 24, 2002

Last revision: Jan 27, 2016

Author(s): Giuseppina Lacerra

Contact

Name: Giuseppina Lacerra

Address: Institute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy

Phone: +39 081 6132602

Email: giuseppina.lacerra@igb.cnr.it

Sequence

AAGTCCACCCCTTCCTTCCTC

Orientation: forward

Position: 36309-29 respect to the Gene Bank sequence NG_000006.1.

Length (nt): 21

Melting Temperature (°C): 59.4

% GC: 57

Degeneration: no

Intended Use: The oligonucleotide has to be used in association with the oligo alpha intergene 3’ to generate a control amplicon of 348 bp.

Quality validation: Yes

The oligo 5’ alpha has been published and used to obtain data published in the peer-reviewed journals reported below.

Citations
Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C. Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system. Haematologica. 2007 Feb;92(2):254-5. PubMed PMID: 17296579.
Lacerra G, Scarano C, Musollino G, Flagiello A, Pucci P, Carestia C. Hb Foggia or alpha 117(GH5)Phe -> Ser: a new alpha 2 globin allele affecting the alpha Hb-AHSP interaction. Haematologica. 2008;93:141-2.
Lacerra G, Scarano C, Musollino G, Testa R, Prezioso R, Caruso DG, Lagona LF, Medulla E, Friscia MG, Gaudiano C, Carestia C. HbA2-Partinico or delta(A2)Pro-->Thr, a new genetic variation in the delta-globin gene in cis to the beta(+) thal IVS-I-110 G>A, and the heterogeneity of delta-globin alleles in double heterozygotes for beta- and delta-globin gene defects. Ann Hematol. 2010;89:127-34.
Lacerra G, Scarano C, Lagona LF, Testa R, Caruso DG, Medulla E, Friscia MG, Mastrullo L, Caldora M, Prezioso R, Gaudiano C, Magnano C, Romeo MA, Musollino G, Di Noce F, Carestia C. Genotype-phenotype relationship of the δ-thalassemia and Hb A(2) variants: observation of 52 genotypes. Hemoglobin. 2010;34:407-23.
Musollino G, Mastrolonardo G, Prezioso R, Pagano L, Primignani P, Carestia C, Lacerra G. Molecular mechanisms of a novel β-thalassaemia mutation due to the duplication of tetranucleotide 'AGCT' at the junction IVS-II/exon 3. Ann Hematol. 2012;91:1695-701.

Funded by: Ministero Istruzione, Università e Ricerca (MIUR), Legge 488/92, Cluster C02, Project 2.

Related Oligos: