Oligo - A Italian(G)g((A)gdb)0-thal I-PCR
Oligo for Inverse PCR amplification assay to define the breakpoint of the deletion Italian(G)g((A)gdb)0-thal. Because the oligos are in inverse direction they cannot generate amplicomers if used on a linear fragment.
Category:
DNA
Creation date: Mar 10, 2009
Last revision: Feb 18, 2016
Author(s):
Giuseppina Lacerra
Contact
Name: Giuseppina Lacerra
Address: Institute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone: +39 081 6132602
Sequence
GTATCCTCTATGATGGGAGA
Orientation: reverse
Position: 5250182-5250163 respect to the Gene Bank sequence NC_000011.10
Length (nt): 20
Melting Temperature (°C): 47.6
% GC: 45
Degeneration: no
Intended Use: It has been used on a circularized fragment (containing the breakpoint of the new deletion) in association with the oligo “B Italian(G)g((A)gdb)0-thal I-PCR” generating a mutation-specific amplicon of 1200 bp.
Quality validation:
Yes
Validation info
The oligo "A Italian(G)g((A)gdb)0-thal I-PCR" has been published and used to obtain data published in the peer-reviewed journals reported below.
Related Protocols:
Related Oligos:
