Log in

Q4lab

Home  |  Molecular Tools  |  Oligos  |  2 South-Italy beta0-thal I-PCR
Home  |  Molecular Tools  |  Oligos  |  2 South-Italy beta0-thal I-PCR

Oligo - 2 South-Italy beta0-thal I-PCR

Oligo for Inverse PCR amplification assay to define the breakpoint of the deletion South-Italy beta0-thal. Because the oligos are in inverse direction they cannot generate amplicomers if used on a linear fragment.

CategoryDNA
Creation dateMar 10, 2009
Last revisionFeb 18, 2016
Author(s)Giuseppina Lacerra
Contact
NameGiuseppina Lacerra
AddressInstitute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone+39 081 6132602
Emailgiuseppina.lacerra@igb.cnr.it

Sequence

AACATCACCTGGATGGGACA

 

Orientationreverse
Position5231222-5231203 respect to the Gene Bank sequence NC_000011.10
Length (nt)20
Melting Temperature (°C)57.2
% GC50
Degenerationno
Intended UseIt has been used on a circularized fragment (containing the breakpoint of the new deletion) in association with the oligo “1 South-Italy beta0-thal I-PCR” generating a mutation-specific amplicon of 1596 bp.

 

Quality validation: Yes

Validation info

The oligo "2 South-Italy beta0-thal I-PCR" has been published and used to obtain data published in the peer-reviewed journals reported below.

 

Citations
De Angioletti M, Sabato V, Musollino G, Prezioso R, Carestia C, Lacerra G. South-Italy β°-thalassemia: a novel deletion not removing the γ-globin silencing element and with 3' breakpoint in a hsRTVL-H element, associated with β°-thalassemia and high levels of HbF. Haematologica. 2013 Aug;98(8):e98-e100. doi: 10.3324/haematol.2013.089722. Epub 2013 Jun 28. PubMed PMID: 23812938; PubMed Central PMCID: PMC3729893.

 

Related Protocols:
Related Oligos:
Document Actions
by Abstract