Oligo - alpha2 N-Hb Icaria / N-Hb Constant Spring
Oligo for allele-splecific amplification to genotype the human alpha2 N-Hb Icaria / N-Hb Constant Spring globin gene mutation
Category:
DNA
Creation date: Mar 31, 2004
Last revision: Jan 26, 2016
Author(s):
Giuseppina Lacerra
Contact
Name: Giuseppina Lacerra
Address: Institute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone: +39 081 6132602
Sequence
GCTGACCTCCAAATACGGTT
Orientation: forward
Position: 34442-61 respect to the Gene Bank sequence NG_000006.1.
Length (nt): 20
Melting Temperature (°C): 58
% GC: 50
Degeneration: no
Intended Use: The oligonucleotide has been designed for an amplification refractory mutation system (ARMS) assay. It generates a normal-specific amplicon of 201 bp, used in association with the oligonucleotide alpha2 + 904.
Quality validation:
Yes
Validation info
The ARMS oligo alpha2 N-Hb Icaria / N-Hb Constant Spring has been published and used to obtain data published in the peer-reviewed journals reported below.
Funded by: Ministero Istruzione, Università e Ricerca (MIUR), Legge 488/92, Cluster C02, Project 2.
Related Oligos: