Log in

Q4lab

Home  |  Molecular Tools  |  Oligos  |  alpha2 ATG>ACG (Nco I)
Home  |  Molecular Tools  |  Oligos  |  alpha2 ATG>ACG (Nco I)

Oligo - alpha2 ATG>ACG (Nco I)

Oligo for allele-splecific amplification to genotype the human alpha2 ATG>ACG globin gene mutation

Category:  DNA
Creation date: Jun 14, 2004
Last revision: Dec 18, 2014
Author(s):  Giuseppina Lacerra
Contact
Name: Giuseppina Lacerra
Address: Institute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone: +39 081 6132602
Email: giuseppina.lacerra@igb.cnr.it

Sequence

GACTCAGAGAGAACCCAGCAC

 

Orientation: forward
Position: 33757-77 respect to the Gene Bank sequence NG_000006.1.
Length (nt): 21
Melting Temperature (°C): 62
% GC: 57
Degeneration: no
Intended Use: The oligonucleotide has been designed for an amplification refractory mutation system (ARMS) assay or allele-specific amplification. It generates a mutation-specific amplicon of 886 bp if it is used in combination with the oligonucleotide alpha2 + 904.

 

Quality validation: Yes

Validation info

The ARMS oligo alpha2 ATG>ACG (Nco I) has been published and used to obtain data published in the peer-reviewed journals reported below.

 

Citations
Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C. Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system. Haematologica. 2007 Feb;92(2):254-5. PubMed PMID: 17296579.
Lacerra G, Scarano C, Musollino G, Flagiello A, Pucci P, Carestia C. Hb Foggia or alpha 117(GH5)Phe -> Ser: a new alpha 2 globin allele affecting the alpha Hb-AHSP interaction. Haematologica. 2008;93:141-2.
Lacerra G, Scarano C, Musollino G, Testa R, Prezioso R, Caruso DG, Lagona LF, Medulla E, Friscia MG, Gaudiano C, Carestia C. HbA2-Partinico or delta(A2)Pro-->Thr, a new genetic variation in the delta-globin gene in cis to the beta(+) thal IVS-I-110 G>A, and the heterogeneity of delta-globin alleles in double heterozygotes for beta- and delta-globin gene defects. Ann Hematol. 2010;89:127-34.
Lacerra G, Scarano C, Lagona LF, Testa R, Caruso DG, Medulla E, Friscia MG, Mastrullo L, Caldora M, Prezioso R, Gaudiano C, Magnano C, Romeo MA, Musollino G, Di Noce F, Carestia C. Genotype-phenotype relationship of the δ-thalassemia and Hb A(2) variants: observation of 52 genotypes. Hemoglobin. 2010;34:407-23.
Musollino G, Mastrolonardo G, Prezioso R, Pagano L, Primignani P, Carestia C, Lacerra G. Molecular mechanisms of a novel β-thalassaemia mutation due to the duplication of tetranucleotide 'AGCT' at the junction IVS-II/exon 3. Ann Hematol. 2012;91:1695-701.

 

Funded by: Ministero Istruzione, Università e Ricerca (MIUR), Legge 488/92, Cluster C02, Project 2.

 

Related Oligos:
Document Actions
by Abstract