Log in

Q4lab

Home  |  Molecular Tools  |  Oligos  |  alpha1 + 916
Home  |  Molecular Tools  |  Oligos  |  alpha1 + 916

Oligo - alpha1 + 916

Common primer for ARMS-PCR detections

Category:  DNA
Creation date: May 14, 1996
Last revision: Jan 26, 2016
Author(s):  Giuseppina Lacerra
Contact
Name: Giuseppina Lacerra
Address: Institute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone: +39 081 6132602
Email: giuseppina.lacerra@igb.cnr.it

Sequence

TGTGTGTCCCAGCTGCTGTCCACGC

 

Orientation: reverse
Position: 38458-34 respect to the Gene Bank sequence NG_000006.1.
Length (nt): 25
Melting Temperature (°C): 60
% GC: 64
Degeneration: no
Intended Use: The oligonucleotide can be used in association with ARMS oligos to generate mutation or normal-specific amplicons. It can be used also for PCR amplification

 

Quality validation: Yes

Validation info

The oligo alpha1 + 916 has been published and used to obtain data published in the peer-reviewed journals reported below.

 

Citations
Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C. Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system. Haematologica. 2007 Feb;92(2):254-5. PubMed PMID: 17296579.
Lacerra G, Scarano C, Musollino G, Flagiello A, Pucci P, Carestia C. Hb Foggia or alpha 117(GH5)Phe -> Ser: a new alpha 2 globin allele affecting the alpha Hb-AHSP interaction. Haematologica. 2008;93:141-2.
Lacerra G, Scarano C, Lagona LF, Testa R, Caruso DG, Medulla E, Friscia MG, Mastrullo L, Caldora M, Prezioso R, Gaudiano C, Magnano C, Romeo MA, Musollino G, Di Noce F, Carestia C. Genotype-phenotype relationship of the δ-thalassemia and Hb A(2) variants: observation of 52 genotypes. Hemoglobin. 2010;34:407-23.
Kidd, JL (2010). Application of an expanded multiplex genotyping assay for the simultaneous detection of Hemoglobin Constant Spring and common deletional alpha-thalassemia mutations. INTERNATIONAL JOURNAL OF LABORATORY HEMATOLOGY 32, 373-380
Musollino G, Mastrolonardo G, Prezioso R, Pagano L, Primignani P, Carestia C, Lacerra G. Molecular mechanisms of a novel β-thalassaemia mutation due to the duplication of tetranucleotide 'AGCT' at the junction IVS-II/exon 3. Ann Hematol. 2012;91:1695-701.

 

Funded by: Ministero Istruzione, Università e Ricerca (MIUR), Legge 488/92, Cluster C02, Project 2.

 

Document Actions
by Abstract