Log in

Q4lab

Home  |  Molecular Tools  |  Oligos  |  alpha1 + 773
Home  |  Molecular Tools  |  Oligos  |  alpha1 + 773

Oligo - alpha1 + 773

Common primer for ARMS-PCR detections

CategoryDNA
Creation dateNov 21, 2002
Last revisionJan 26, 2016
Author(s)Giuseppina Lacerra
Contact
NameGiuseppina Lacerra
AddressInstitute of Genetics and Biophysics A. Buzzati-Traverso - Via Pietro Castellino, 111, 80131 Naples, Italy
Phone+39 081 6132602
Emailgiuseppina.lacerra@igb.cnr.it

Sequence

GAGGCCCAAGGGGCAAGAAGCAT

 

Orientationreverse
Position38315-293 respect to the Gene Bank sequence NG_000006.1.
Length (nt)23
Melting Temperature (°C)62
% GC61
Degenerationno
Intended UseThe oligonucleotide can be used in association with ARMS oligos to generate mutation or normal-specific amplicons. It can be used also for PCR amplification.

 

Quality validation: Yes

Validation info

The oligo alpha1 + 773 has been published and used to obtain data published in the peer-reviewed journals reported below.

 

Citations
Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C. Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system. Haematologica. 2007 Feb;92(2):254-5. PubMed PMID: 17296579.
Lacerra G, Scarano C, Musollino G, Flagiello A, Pucci P, Carestia C. Hb Foggia or alpha 117(GH5)Phe -> Ser: a new alpha 2 globin allele affecting the alpha Hb-AHSP interaction. Haematologica. 2008;93:141-2.
Lacerra G, Scarano C, Musollino G, Testa R, Prezioso R, Caruso DG, Lagona LF, Medulla E, Friscia MG, Gaudiano C, Carestia C. HbA2-Partinico or delta(A2)Pro-->Thr, a new genetic variation in the delta-globin gene in cis to the beta(+) thal IVS-I-110 G>A, and the heterogeneity of delta-globin alleles in double heterozygotes for beta- and delta-globin gene defects. Ann Hematol. 2010;89:127-34.
Lacerra G, Scarano C, Lagona LF, Testa R, Caruso DG, Medulla E, Friscia MG, Mastrullo L, Caldora M, Prezioso R, Gaudiano C, Magnano C, Romeo MA, Musollino G, Di Noce F, Carestia C. Genotype-phenotype relationship of the δ-thalassemia and Hb A(2) variants: observation of 52 genotypes. Hemoglobin. 2010;34:407-23.
Musollino G, Mastrolonardo G, Prezioso R, Pagano L, Primignani P, Carestia C, Lacerra G. Molecular mechanisms of a novel β-thalassaemia mutation due to the duplication of tetranucleotide 'AGCT' at the junction IVS-II/exon 3. Ann Hematol. 2012;91:1695-701.

 

Funded byMinistero Istruzione, Università e Ricerca (MIUR), Legge 488/92, Cluster C02, Project 2.

 

Document Actions
by Abstract